| Name | Description | Tags | Text |
|---|---|---|---|
inspcr | - only one set of primers (?) | ||
pypcrtool | - possibility to choose how many mistakes can be in the primer sequence | Chi-Feng (running it with two mistakes) | |
primerJinn | - multiple primers (?) - designed for one bacterial sequence (I managed to write a script to do sequences one by one) - shows up dimers | ||
pincer | (outdated program - didn’t work) |
- Presentation about what is PCR ✅
- there is total 794112 separate fasta files
Sandbox/Positive control:
chosen sequence
mv /scratch/kms9971/PCR_karo/NODE_9998_length_1843_cov_1.782998 /scratch/kms9971/positive_control_PCR
Primers version 1:
GCTGTTAGTGATATTGCCAA (forward)
GCATTGCGGCTCAGAAACCG (reverse)
What I am confused about is shouldnt the forward primer be the oposite of the sequence to see if it binds (?)
Primers version 2:
mv /scratch/kms9971/PCR_karo/NODE_9998_length_2487_cov_2.414062 /scratch/kms9971/
mv /scratch/kms9971/PCR_karo/NODE_99947_length_532_cov_1.448637 /scratch/kms9971/